Skip to main content
Addgene

pACYC-GroEL/ES-TF
(Plasmid #83923)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83923 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pACYCDuet-1
  • Backbone manufacturer
    EMD Millipore
  • Total vector size (bp) 7166
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Gro EL/ES
  • Species
    E. coli
  • Promoter T7

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ggatctcgacgctctccct
  • 3′ sequencing primer gattatgcggccgtgtacaa
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Trigger Factor
  • Species
    E. coli
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ttgtacacggccgcataatc
  • 3′ sequencing primer gctagttattgctcagcgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACYC-GroEL/ES-TF was a gift from Karl Griswold (Addgene plasmid # 83923 ; http://n2t.net/addgene:83923 ; RRID:Addgene_83923)
  • For your References section:

    Engineering Escherichia coli for soluble expression and single step purification of active human lysozyme. Lamppa JW, Tanyos SA, Griswold KE. J Biotechnol. 2013 Mar 10;164(1):1-8. doi: 10.1016/j.jbiotec.2012.11.007. Epub 2012 Dec 7. 10.1016/j.jbiotec.2012.11.007 PubMed 23220215