pACYC-Skp-TF
(Plasmid #83921)

• Purpose: Co-expresses cytoplasmic copies of the Skp and Trigger Factor protein folding chaperones.
• Depositing Lab: Karl Griswold
• Publication: Lamppa et al J Biotechnol. 2013 Mar 10;164(1):1-8. doi: 10.1016/j.jbiotec.2012.11.007. Epub 2012 Dec 7.

Backbone

• Vector backbone: pACYCDuet-1
• Backbone manufacturer: EMD Millipore
• Total vector size (bp): 5608
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Skp
• Species: E. coli
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ggatctcgacgctctccct
• 3′ sequencing primer: gattatgcggccgtgtacaa

Gene/Insert 2

• Gene/Insert name: Trigger Factor
• Species: E. coli
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: ttgtacacggccgcataatc
• 3′ sequencing primer: gctagttattgctcagcgg

Resource Information

• Supplemental Documents:
  • Annotated plasmid file in Genbank format.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry