Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET32bplus_trx_dAChE4
(Plasmid #83917)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83917 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET32b+
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5851
  • Total vector size (bp) 7504
  • Modifications to backbone
    addition of three nucleotides, GTT, at 7339-7441
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Designed hAChE, codon optimised for E.coli expression
  • Alt name
    dAChE4
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1653
  • Mutation
    V13T,K24T,M43V,L49R,V61W,S68N,E92N,T110K,S111N,T113A,L116M,A128S,Q141R,A142T,T145V,V188I,V227I,G235A,T239Y,G241S,M242R,G243E,T250L,H254K,T276N,A279P,V281E,S310P,A319N,H323K,Q326D,V332N,A358E,A362E,V379I,R394K,L395N,E397D,V409I,L415F,G417Q,L419Y,Q422N,A435S,S439P,L442E,A468K,Q475R,G507D,A508E,Q510K
  • GenBank ID
    M55040.1
  • Entrez Gene
    ACHE (a.k.a. ACEE, ARACHE, N-ACHE, YT)
  • Promoter T7 promoter
  • Tags / Fusion Proteins
    • TRX (N terminal on backbone)
    • His (N terminal on backbone)
    • S-tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer aaattcgaacgccagcacatgg
  • 3′ sequencing primer caaaaaacccctcaagacccg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET32bplus_trx_dAChE4 was a gift from Sarel Fleishman (Addgene plasmid # 83917 ; http://n2t.net/addgene:83917 ; RRID:Addgene_83917)
  • For your References section:

    Automated Structure- and Sequence-Based Design of Proteins for High Bacterial Expression and Stability. Goldenzweig A, Goldsmith M, Hill SE, Gertman O, Laurino P, Ashani Y, Dym O, Unger T, Albeck S, Prilusky J, Lieberman RL, Aharoni A, Silman I, Sussman JL, Tawfik DS, Fleishman SJ. Mol Cell. 2016 Jul 21;63(2):337-46. doi: 10.1016/j.molcel.2016.06.012. Epub 2016 Jul 14. 10.1016/j.molcel.2016.06.012 PubMed 27425410