pLV-dCas9-KRAB-PGK-HygR
(Plasmid #83890)

• Purpose: Lentiviral Sp dCas9-KRAB fusion with Hygromycin B resistance cassette.
• Depositing Lab: Charles Gersbach
• Publication: Klann et al Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853.

Backbone

• Vector backbone: FUGW
• Total vector size (bp): 15000
• Vector type: Lentiviral, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: humanized dead Cas9 KRAB
• Species: S. Pyogenes
• Mutation: D10A and H840A
• Promoter: Human Ubiquitin C Promoter
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGGACGCCACACTGATTCAT
• 3′ sequencing primer: CTACCGGTGGATGTGGAATG

Gene/Insert 2

• Gene/Insert name: aminoglycoside phosphotransferase from E. coli
• Alt name: aph(4)-Ia
• Alt name: Hygromycin resistance gene
• Species: E. coli
• Insert Size (bp): 1026
• Promoter: mouse phosphoglycerate kinase 1 promoter

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AGCTTACTAAGCCAGATGTG
• 3′ sequencing primer: ATGAAAGCCATACGGGAAGC

Resource Information

• Supplemental Documents:
  • GenBank File
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry