pPJ174(JPUB_006779)
(Plasmid #83827)

• Purpose: Carries operon 1 final
• Depositing Lab: Harry Beller
• Publication: Javidpour et al PLoS One. 2016 Mar 14;11(3):e0151087. doi: 10.1371/journal.pone.0151087. eCollection 2016.

Backbone

• Vector backbone: pFAB217 (p15 ori, kanR)
• Vector type: pFAB217 (p15A ori, kanR)
• Selectable markers: Kan

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Kuste3603
• Alt name: ACP
• Insert Size (bp): 261
• Promoter: op1_3603_for

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ttttttggtctcataatgaatgatgaagaaattgagaaaggtg

Gene/Insert 2

• Gene/Insert name: kuste3605
• Alt name: FabF(beta-ketoacyl -ACP synthase II)
• Insert Size (bp): 1221
• Promoter: op1_3605_for

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ttttttggtctcatctaatggataaacgtgtggttattaccg

Gene/Insert 3

• Gene/Insert name: kuste3606
• Alt name: non-canonical FabF
• Insert Size (bp): 1239
• Promoter: op1_3606_for

Cloning Information for Gene/Insert 3

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ttttttggtctcaatgggcgacacgcgtattgttatcacc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry