recoverin1a
(Plasmid
#83811)
-
Purposeexpress zebrafish recoverin1a
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83811 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCRII-TOPO
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 3973
- Total vector size (bp) 4585
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerecoverin1a
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)612
-
Mutation*(see below)
-
GenBank IDKT325590
-
Entrez Genercvrna (a.k.a. rcv1a, zgc:114180)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer GGACCAGAGTACAATTTAAG
- 3′ sequencing primer GAAGCTCTAATCAGTCATAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
*Note: Addgene's quality control sequencing identified D82G & M177T amino acid residue substitutions. The effects of these residue changes is unknown.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
recoverin1a was a gift from Stephan Neuhauss (Addgene plasmid # 83811 ; http://n2t.net/addgene:83811 ; RRID:Addgene_83811) -
For your References section:
Recoverin depletion accelerates cone photoresponse recovery. Zang J, Keim J, Kastenhuber E, Gesemann M, Neuhauss SC. Open Biol. 2015 Aug;5(8). pii: 150086. doi: 10.1098/rsob.150086. 10.1098/rsob.150086 PubMed 26246494