-
PurposeExpress Sg-2 sgRNA targeting GAPDH
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83809 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMLM3636
- Backbone size w/o insert (bp) 2278
- Total vector size (bp) 2289
-
Modifications to backboneThe oligos with overhang were synthesized, annealed and ligated into the sgRNA backbone linearized with BsmB1.
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSgRNA
-
gRNA/shRNA sequenceAGCCCCAGCAAGAGCACAAG (AGG)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgRNA 2 GAPDH was a gift from Bo Feng (Addgene plasmid # 83809 ; http://n2t.net/addgene:83809 ; RRID:Addgene_83809) -
For your References section:
Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair. He X, Tan C, Wang F, Wang Y, Zhou R, Cui D, You W, Zhao H, Ren J, Feng B. Nucleic Acids Res. 2016 May 19;44(9):e85. doi: 10.1093/nar/gkw064. Epub 2016 Feb 4. 10.1093/nar/gkw064 PubMed 26850641