pBES2
(Plasmid #83800)

• Purpose: Useful for tagging yeast proteins with N-terminal Venus tag; G418 selection
• Depositing Lab: Eric Muller
• Publication: Hailey et al Methods Enzymol. 2002;351:34-49.

Backbone

• Vector backbone: pDH22
• Backbone manufacturer: Muller Lab, Addgene plasmid #83798
• Modifications to backbone: YFP has been mutated to the Venus variant
• Vector type: Yeast Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Venus

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TEF-terminator-F, CCCAGATGCGAAGTTAAGTG
• 3′ sequencing primer: T7

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For more information, see http://yeastrc.org/yeastrc/pages/plasmids_protocols.html
Venus mutations are described in "A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications" by Nagai, Ibata, Park, Kubota, Mikoshiba and Miyawaki in Nat Biotechnol 2002;20:87-90. In addition we have included Q69M, a mutation briefly mentioned in the Nagai et al. paper as potentially beneficial, although not necessary for the enhanced maturation.