Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLMB738
(Plasmid #83791)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83791 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pIJ11268
  • Backbone size w/o insert (bp) 16260
  • Total vector size (bp) 17452

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    E. coli S17-1
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Region upstream RL0102 (gabT) containing all of RL0103
  • Species
    Rhizobium leguminosarum bv. viciae, strain 3841
  • Insert Size (bp)
    1192

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CCATCTTTGCCCTACCGTAT
  • 3′ sequencing primer AAACCGACGCCATCACCCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLMB738 was a gift from Philip Poole (Addgene plasmid # 83791 ; http://n2t.net/addgene:83791 ; RRID:Addgene_83791)
  • For your References section:

    Bacterial Biosensors for in Vivo Spatiotemporal Mapping of Root Secretion. Pini F, East AK, Appia-Ayme C, Tomek J, Karunakaran R, Mendoza-Suarez M, Edwards A, Terpolilli JJ, Roworth J, Downie JA, Poole PS. Plant Physiol. 2017 Jul;174(3):1289-1306. doi: 10.1104/pp.16.01302. Epub 2017 May 11. 10.1104/pp.16.01302 PubMed 28495892