MSCV-6NBC-GFP-PGK-Puro-Barcode12
(Plasmid
#83689)
-
Purposeindividual 6N barcode to make barcoded cell line variants
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMSCV
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBarcode12
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-6NBC-GFP-PGK-Puro-Barcode12 was a gift from Monte Winslow (Addgene plasmid # 83689 ; http://n2t.net/addgene:83689 ; RRID:Addgene_83689) -
For your References section:
An in vivo multiplexed small-molecule screening platform. Gruner BM, Schulze CJ, Yang D, Ogasawara D, Dix MM, Rogers ZN, Chuang CH, McFarland CD, Chiou SH, Brown JM, Cravatt BF, Bogyo M, Winslow MM. Nat Methods. 2016 Sep 12. doi: 10.1038/nmeth.3992. 10.1038/nmeth.3992 PubMed 27617390