Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCA24N_6xHis-TEV-rpsA
(Plasmid #83585)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83585 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCA24N
  • Backbone size w/o insert (bp) 4520
  • Total vector size (bp) 6191
  • Modifications to backbone
    Mutate amino acids downstream of His tag from TDPALRA to ENLYFQG to make TEV cleavage site. Remove last 5 C-terminal amino acids which are not present in rpsA.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use plates with 68 ug/mL chloramphenicol for transformation, then replate onto plates with 170 ug/mL if desired. When growing for protein expression, use 68 ug/mL antibiotic in liquid media.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    rpsA
  • Alt name
    ribosomal protein S1
  • Alt name
    JW0894
  • Species
    Escherichia coli
  • GenBank ID
    NC_000913.3 (961995..963668) NP_415431
  • Entrez Gene
    rpsA (a.k.a. b0911, ECK0902, JW0894, ssyF)
  • Promoter p-T5 Lac
  • Tag / Fusion Protein
    • His tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (destroyed during cloning)
  • 3′ cloning site SfiI (destroyed during cloning)
  • 5′ sequencing primer caggaaacagctatgacc
  • 3′ sequencing primer cgagcgttctgaacaaatcc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The parent plasmid used as starting material for mutagenesis came from the ASKA library via Professor Janine Maddock (Molecular, Cellular & Developmental Biology, University of Michigan), under whose supervision this work was performed.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCA24N_6xHis-TEV-rpsA was a gift from Nils Walter (Addgene plasmid # 83585 ; http://n2t.net/addgene:83585 ; RRID:Addgene_83585)
  • For your References section:

    Protein unties the pseudoknot: S1-mediated unfolding of RNA higher order structure. Lund PE, Chatterjee S, Daher M, Walter NG. Nucleic Acids Res. 2019 Dec 13. pii: 5674991. doi: 10.1093/nar/gkz1166. 10.1093/nar/gkz1166 PubMed 31832686