pIRES-hrGFP II-mTET1
(Plasmid #83569)

• Purpose: Expresses TET1 with a mutated catalytic domain in mammalian cells
• Depositing Lab: Jean-Pierre Issa
• Publication: Jin et al Nucleic Acids Res. 2014 Jun;42(11):6956-71. doi: 10.1093/nar/gku372. Epub 2014 May 29.

Backbone

• Vector backbone: pIRES-hrGFPII
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 11908
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Stbl3 bacteria should be used for transformation and plasmid should be grown at 37 for extended periods.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Tet Methylcytosine Dioxygenase 1
• Alt name: TET1
• Species: H. sapiens (human)
• Insert Size (bp): 6408
• Mutation: catalytic domain mutant H1672D, D1674A
• GenBank ID: NM_030625
• Entrez Gene: TET1 (a.k.a. CXXC6, LCX, bA119F7.1)
• Promoter: CMV
• Tags / Fusion Proteins:
  • 3X FLAG tag (C terminal on backbone)
  • hr GFP II (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: ATGGGCGGTAGGCGTGTA
• 3′ sequencing primer: ATGCAGTCGTCGAGGAATTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mutation location described in the following publication: Minimal role of base excision repair in TET-induced global DNA demethylation in HEK293T cells, EPIGENETICS 2015