pLEX_307-SOD1E133K
(Plasmid
#83447)
-
PurposeMammalian expression of SOD1E133K
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83447 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLEX_307 (plasmid #41392)
-
Backbone manufacturerDavid Root
- Backbone size w/o insert (bp) 10065
- Total vector size (bp) 8767
-
Modifications to backboneRemoval of gateway cloning cassette and V5 tag
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsNo longer than 16 hours culture.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSOD1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)720
-
MutationE133K
-
Entrez GeneSOD1 (a.k.a. ALS, ALS1, HEL-S-44, IPOA, SOD, STAHP, hSod1, homodimer)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer EF-1α_F
- 3′ sequencing primer WPRE_R (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMohan Babu lab (pSOD1E133K-AcGFP1, #83442)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PCR cloning (F: TAAGCAGCTAGCAGCTCAGATCTCGAGCTCAAGC, R: TAAGCAACTAGTTCATTGGGCGATCCCAATTACACC) followed by cleanup, NheI/SpeI restriction digestion of PCR product and destination vector, gel purification and ligation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEX_307-SOD1E133K was a gift from Mohan Babu (Addgene plasmid # 83447 ; http://n2t.net/addgene:83447 ; RRID:Addgene_83447) -
For your References section:
A Map of Human Mitochondrial Protein Interactions Linked to Neurodegeneration Reveals New Mechanisms of Redox Homeostasis and NF-kappaB Signaling. Malty RH, Aoki H, Kumar A, Phanse S, Amin S, Zhang Q, Minic Z, Goebels F, Musso G, Wu Z, Abou-Tok H, Meyer M, Deineko V, Kassir S, Sidhu V, Jessulat M, Scott NE, Xiong X, Vlasblom J, Prasad B, Foster LJ, Alberio T, Garavaglia B, Yu H, Bader GD, Nakamura K, Parkinson J, Babu M. Cell Syst. 2017 Nov 7. pii: S2405-4712(17)30447-7. doi: 10.1016/j.cels.2017.10.010. 10.1016/j.cels.2017.10.010 PubMed 29128334