ptdTomato-SMCR8
(Plasmid #83438)

• Purpose: Expresses SMCR8-tdTomato in mammalian cells
• Depositing Lab: Shawn Ferguson
• Publication: Amick et al Mol Biol Cell. 2016 Aug 24. pii: mbc.E16-01-0003.

Backbone

• Vector backbone: ptdTomato-N1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Human SMCR8
• Species: H. sapiens (human)
• Entrez Gene: SMCR8 (a.k.a. DENND8A)
• Promoter: CMV
• Tag / Fusion Protein:
  • tdTomato (C terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry