pEGFP-Rab21-T31N (DN)
(Plasmid
#83423)
-
PurposeMouse Rab21 mutant that has defects in the binding of GTP (dominant negative). Generated from pEGFP-Rab21 by site-directed mutagenesis.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
- Backbone size w/o insert (bp) 4681
- Total vector size (bp) 5358
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRab21
-
Alt nameMus musculus RAB21, member RAS oncogene family (Rab21)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)677
-
MutationResidue 31 from T to N (T31N: ACG -> AAC)
-
GenBank IDNM_024454.1
-
Entrez GeneRab21 (a.k.a. 9630024B22)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer EGFP-C: CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-Rab21-T31N (DN) was a gift from Johanna Ivaska (Addgene plasmid # 83423 ; http://n2t.net/addgene:83423 ; RRID:Addgene_83423) -
For your References section:
Small GTPase Rab21 regulates cell adhesion and controls endosomal traffic of beta1-integrins. Pellinen T, Arjonen A, Vuoriluoto K, Kallio K, Fransen JA, Ivaska J. J Cell Biol. 2006 Jun 5;173(5):767-80. 10.1083/jcb.200509019 PubMed 16754960