Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-Rab21-Q76L (CA)
(Plasmid #83422)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83422 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone size w/o insert (bp) 4681
  • Total vector size (bp) 5358
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rab21
  • Alt name
    Mus musculus RAB21, member RAS oncogene family (Rab21)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    677
  • Mutation
    Residue 76 from Q to L (Q76L: CAG -> CTG)
  • GenBank ID
    NM_024454.1
  • Entrez Gene
    Rab21 (a.k.a. 9630024B22)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer EGFP-C: CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-Rab21-Q76L (CA) was a gift from Johanna Ivaska (Addgene plasmid # 83422 ; http://n2t.net/addgene:83422 ; RRID:Addgene_83422)
  • For your References section:

    Small GTPase Rab21 regulates cell adhesion and controls endosomal traffic of beta1-integrins. Pellinen T, Arjonen A, Vuoriluoto K, Kallio K, Fransen JA, Ivaska J. J Cell Biol. 2006 Jun 5;173(5):767-80. 10.1083/jcb.200509019 PubMed 16754960