pEGFP-Rab21-Q76L (CA)
(Plasmid #83422)

• Purpose: Mouse Rab21 mutant that has defects in GTP hydrolysis (GTP-locked, constitutively active). Generated from pEGFP-Rab21 by site-directed mutagenesis.
• Depositing Lab: Johanna Ivaska
• Publication: Pellinen et al J Cell Biol. 2006 Jun 5;173(5):767-80.

Backbone

• Vector backbone: pEGFP-C1
• Backbone size w/o insert (bp): 4681
• Total vector size (bp): 5358
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Rab21
• Alt name: Mus musculus RAB21, member RAS oncogene family (Rab21)
• Species: M. musculus (mouse)
• Insert Size (bp): 677
• Mutation: Residue 76 from Q to L (Q76L: CAG -> CTG)
• GenBank ID: NM_024454.1
• Entrez Gene: Rab21 (a.k.a. 9630024B22)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (unknown if destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: EGFP-C: CATGGTCCTGCTGGAGTTCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry