Skip to main content
Addgene

pSOD1E133Δ-AcGFP1
(Plasmid #83419)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83419 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAcGFP1-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5184
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SOD1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    720
  • Mutation
    E133 deletion
  • Entrez Gene
    SOD1 (a.k.a. ALS, ALS1, HEL-S-44, IPOA, SOD, STAHP, hSod1, homodimer)
  • Promoter CMV
  • Tag / Fusion Protein
    • AcGFP1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer AcGFP1_R (GGCCATTCACATCGCCATTC)
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Elizabeth Fisher( pF147 pSOD1A4VAcGFP1, #26408)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mutation (first described in PMID: 8938700) was created using the method described in PMID: 17446874. Two outer and two mutation-site primers were used. The mutated PCR product and the backbone vector were digested using EcoRI and SalI, gel purified and ligated.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSOD1E133Δ-AcGFP1 was a gift from Mohan Babu (Addgene plasmid # 83419 ; http://n2t.net/addgene:83419 ; RRID:Addgene_83419)

  • For your References section:

    A Map of Human Mitochondrial Protein Interactions Linked to Neurodegeneration Reveals New Mechanisms of Redox Homeostasis and NF-kappaB Signaling. Malty RH, Aoki H, Kumar A, Phanse S, Amin S, Zhang Q, Minic Z, Goebels F, Musso G, Wu Z, Abou-Tok H, Meyer M, Deineko V, Kassir S, Sidhu V, Jessulat M, Scott NE, Xiong X, Vlasblom J, Prasad B, Foster LJ, Alberio T, Garavaglia B, Yu H, Bader GD, Nakamura K, Parkinson J, Babu M. Cell Syst. 2017 Nov 7. pii: S2405-4712(17)30447-7. doi: 10.1016/j.cels.2017.10.010. 10.1016/j.cels.2017.10.010 PubMed 29128334
Related items: