Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

negActinin-sstFRET-GR
(Plasmid #83417)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83417 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP c1 derivative
  • Backbone size w/o insert (bp) 3953
  • Total vector size (bp) 8387
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    negActinin-sstFRET
  • Insert Size (bp)
    4434
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    negActinin-sstFRET-GR was a gift from Tetsuya Kitaguchi (Addgene plasmid # 83417 ; http://n2t.net/addgene:83417 ; RRID:Addgene_83417)
  • For your References section:

    Observations of intracellular tension dynamics of MC3T3-E1 cells during substrate adhesion using a FRET-based actinin tension sensor. Wang J, Ito M, Zhong W, Sugita S, Michiue T, Tsuboi T, Kitaguchi T, Matsumoto T. J Biomech Sci Eng (2016). Vol.11, No.4 10.1299/jbse.16-00504