Actinin-sstFRET-GR
(Plasmid
#83416)
-
PurposeFRET-based actinin tension sensor
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83416 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP c1 derivative
- Backbone size w/o insert (bp) 3953
- Total vector size (bp) 8387
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameActinin-sstFRET-GR
-
Insert Size (bp)4434
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Actinin-sstFRET-GR was a gift from Tetsuya Kitaguchi (Addgene plasmid # 83416 ; http://n2t.net/addgene:83416 ; RRID:Addgene_83416) -
For your References section:
Observations of intracellular tension dynamics of MC3T3-E1 cells during substrate adhesion using a FRET-based actinin tension sensor. Wang J, Ito M, Zhong W, Sugita S, Michiue T, Tsuboi T, Kitaguchi T, Matsumoto T. J Biomech Sci Eng (2016). Vol.11, No.4 10.1299/jbse.16-00504