-
PurposeExpressed N-term tagged UnaG on Sec61B
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83413 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5378
- Total vector size (bp) 6120
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUnaG-Sec61B
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)742
-
GenBank IDNM_006808.2. NM_006808.2.
-
Entrez GeneSEC61B
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer tagtaggaattcatgcctggtccgacccc
- 3′ sequencing primer tagtagctcgagTCAcgaacgagtgtacttgcccca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA3_UnaG-Flag-Sec61B was a gift from Hyun-Woo Rhee (Addgene plasmid # 83413 ; http://n2t.net/addgene:83413 ; RRID:Addgene_83413) -
For your References section:
In Cellulo Mapping of Subcellular Localized Bilirubin. Park JS, Nam E, Lee HK, Lim MH, Rhee HW. ACS Chem Biol. 2016 May 27. 10.1021/acschembio.6b00017 PubMed 27232847