pUC-TALO8
(Plasmid #83409)

• Purpose: TRP1-ARS1-8xLacO (TALO8) minichromosome system for histone purification in yeast
• Depositing Lab: Toshi Tsukiyama
• Publication: Unnikrishnan et al Nat Struct Mol Biol. 2010 Apr;17(4):430-7. doi: 10.1038/nsmb.1780. Epub 2010 Mar 14.

Backbone

• Vector backbone: pUC
• Backbone manufacturer: unknown
• Vector type: Yeast Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: grow at 30 °C in the presence of 1 mM IPTG in both plate and liquid media, in order to keep eight copies of LacO. Upon maxi-prep, we test the copy number of LacO by PCR using the following primers: R-20: CAGCTATGACCATGATTACG pDTL11: AATGCGAGATCCGTTTAAC
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TRP-ARS-8xLacO
• Species: Synthetic
• Mutation: Please see depositor comments below
• Promoter: TRP1

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: M13pUC-Fwd
• 3′ sequencing primer: M13 Reverse

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note- Addgene's quality control full plasmid sequence found
several single A->G mismatches in lacO sites 5 and 7. The depositor noted that these discrepancies do NOT affect plasmid function.

To transform yeast, we remove pUC backbone by cutting pUC-TALO8 with EcoRI, isolating ~1.7 kb fragment, and self-ligating it in vitro. We then directly transform yeast with the ligation mixture.
Purification protocol can be found here:
http://research.fhcrc.org/content/dam/stripe/tsukiyama/files/Protocols/TALO8_Protocol.pdf