pVP16-tev-PRT1-C195A
(Plasmid #83408)

• Purpose: bacterial expression vector pVP16 containing a mutant variant of Arabidopsis thaliana PROTEOLYSIS 1 (PRT1) N-end rule E3 ubiquitin ligase to be used in N-end rule in vitro ubiquitination studies
• Depositing Lab: Nico Dissmeyer
• Publication: PRT1 clones (unpublished)

Backbone

• Vector backbone: pVP16
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): BL21
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PROTEOLYSIS1 (PRT1)
• Species: A. thaliana (mustard weed); E. coli
• Insert Size (bp): 450
• Mutation: C195A substitution
• GenBank ID: 822078
• Entrez Gene: PRT1 (a.k.a. AT3G24800, proteolysis 1)
• Tags / Fusion Proteins:
  • His8 (N terminal on backbone)
  • MBP (N terminal on backbone)
  • tev cleavage site (N terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: gatgtccgctttctggtatgc
• 3′ sequencing primer: GTTCTGAGGTCATTACTGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry