His8:MBP-tev-Gly-eK-Flv
(Plasmid #83383)

• Purpose: bacterial expression vector pVP16 containing a derivative of E. coli lacZ fused with E. coli flavin binding protein MioC to be used in N-end rule in vitro ubiquitination studies
• Depositing Lab: Nico Dissmeyer
• Publication: artificial N-end rule substrates (unpublished)

Backbone

• Vector backbone: pVP16
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): BL21
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: flavin binding protein MioC
• Species: E. coli
• Insert Size (bp): 450
• GenBank ID: WP_080028772.1
• Tags / Fusion Proteins:
  • 8xHis (N terminal on backbone)
  • MBP (N terminal on backbone)
  • 3xHA (N terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: gatgtccgctttctggtatgc
• 3′ sequencing primer: GTTCTGAGGTCATTACTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry