Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCFD3-ebony
(Plasmid #83380)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83380 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCFD3
  • Backbone manufacturer
    Bullock and Port
  • Backbone size w/o insert (bp) 6229
  • Total vector size (bp) 6249
  • Modifications to backbone
    Insertion of ebony target sequence into Bbs1 site of pCFD3
  • Vector type
    Insect Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ebony
  • Alt name
    gRNA-ebony
  • gRNA/shRNA sequence
    GCCACAATTGTCGATCGTCA
  • Species
    D. melanogaster (fly)
  • Entrez Gene
    e (a.k.a. Dmel_CG3331, CG3331, Dmel\CG3331, Ebony)

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The pCFD3 vector and ebony gRNA sequence are from Bullock and Port.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCFD3-ebony was a gift from Richard Padgett (Addgene plasmid # 83380 ; http://n2t.net/addgene:83380 ; RRID:Addgene_83380)
  • For your References section:

    Efficient Screening of CRISPR/Cas9-Induced Events in Drosophila Using a Co-CRISPR Strategy. Kane NS, Vora M, Varre KJ, Padgett RW. G3 (Bethesda). 2017 Jan 5;7(1):87-93. doi: 10.1534/g3.116.036723. 10.1534/g3.116.036723 PubMed 27793971