pCFD3-ebony
(Plasmid #83380)

• Purpose: Drosophila gRNA expression plasmid targets ebony
• Depositing Lab: Richard Padgett
• Publication: Kane et al G3 (Bethesda). 2017 Jan 5;7(1):87-93. doi: 10.1534/g3.116.036723.

Backbone

• Vector backbone: pCFD3
• Backbone manufacturer: Bullock and Port
• Backbone size w/o insert (bp): 6229
• Total vector size (bp): 6249
• Modifications to backbone: Insertion of ebony target sequence into Bbs1 site of pCFD3
• Vector type: Insect Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ebony
• Alt name: gRNA-ebony
• gRNA/shRNA sequence: GCCACAATTGTCGATCGTCA
• Species: D. melanogaster (fly)
• Entrez Gene: e (a.k.a. Dmel_CG3331, CG3331, Dmel\CG3331, Ebony)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: T3
• 3′ sequencing primer: M13Rev

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The pCFD3 vector and ebony gRNA sequence are from Bullock and Port.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry