pET28a-soNadV
(Plasmid
#83363)
-
PurposeExpresses nadV from Shewanella oneidensis in Escherichia coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a(+)
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5227
- Total vector size (bp) 6721
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namenadV
-
Alt namenicotinamide phosphoribosyltransferase
-
Alt nameNAMPT
-
SpeciesShewanella oneidensis MR-1
-
Insert Size (bp)1484
-
GenBank ID1169740
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
nadV gene has been codon optimized for E. coli expression
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-soNadV was a gift from George Cătălin Marinescu (Addgene plasmid # 83363 ; http://n2t.net/addgene:83363 ; RRID:Addgene_83363) -
For your References section:
beta-nicotinamide mononucleotide (NMN) production in Escherichia coli. Marinescu GC, Popescu RG, Stoian G, Dinischiotu A. Sci Rep. 2018 Aug 16;8(1):12278. doi: 10.1038/s41598-018-30792-0. 10.1038/s41598-018-30792-0 PubMed 30115969