pET28a-hdNadV
(Plasmid #83362)

• Purpose: Expresses nadV from Haemophilus ducreyi in Escherichia coli
• Depositing Lab: George Cătălin Marinescu
• Publication: Marinescu et al Sci Rep. 2018 Mar 13;8(1):4433. doi: 10.1038/s41598-018-22806-8.

Backbone

• Vector backbone: pET28a(+)
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5227
• Total vector size (bp): 6733
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: nadV
• Alt name: NAMPT
• Alt name: Putative nicotinamide phosphoribosyl transferase
• Species: Haemophilus ducreyi
• Insert Size (bp): 1496
• GenBank ID: NC_005329.1
• Promoter: T7
• Tag / Fusion Protein:
  • none

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The gene is codon optimized for Escherichia coli expression. The synthetic nadV gene optimized for E coli expression has been inserted between NcoI/XhoI restriction sites in pET28a(+) vector