Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET28a-hdNadV
(Plasmid #83362)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83362 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28a(+)
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5227
  • Total vector size (bp) 6733
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    nadV
  • Alt name
    NAMPT
  • Alt name
    Putative nicotinamide phosphoribosyl transferase
  • Species
    Haemophilus ducreyi
  • Insert Size (bp)
    1496
  • GenBank ID
    NC_005329.1
  • Promoter T7
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The gene is codon optimized for Escherichia coli expression. The synthetic nadV gene optimized for E coli expression has been inserted between NcoI/XhoI restriction sites in pET28a(+) vector

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-hdNadV was a gift from George Cătălin Marinescu (Addgene plasmid # 83362 ; http://n2t.net/addgene:83362 ; RRID:Addgene_83362)
  • For your References section:

    Size Exclusion Chromatography Method for Purification of Nicotinamide Mononucleotide (NMN) from Bacterial Cells. Marinescu GC, Popescu RG, Dinischiotu A. Sci Rep. 2018 Mar 13;8(1):4433. doi: 10.1038/s41598-018-22806-8. 10.1038/s41598-018-22806-8 [pii] PubMed 29535407