Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEX-cIAP2mut
(Plasmid #8336)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 8336 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX
  • Backbone size w/o insert (bp) 4900
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ciap2mut
  • Alt name
    cIAP2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1800
  • Mutation
    H574A
  • Entrez Gene
    BIRC3 (a.k.a. AIP1, API2, CIAP2, HAIP1, HIAP1, IAP-1, MALT2, MIHC, RNF49, c-IAP2)
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTGG
  • 3′ sequencing primer TCCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-cIAP2mut was a gift from Jon Ashwell (Addgene plasmid # 8336 ; http://n2t.net/addgene:8336 ; RRID:Addgene_8336)
  • For your References section:

    TNF-RII and c-IAP1 mediate ubiquitination and degradation of TRAF2. Li X, Yang Y, Ashwell JD. Nature 2002 Mar 21;416(6878):345-7. 10.1038/416345a PubMed 11907583