Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTriEX-Antenna-GDI Rac1
(Plasmid #83359)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83359 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTriEx
  • Backbone size w/o insert (bp) 5238
  • Total vector size (bp) 7228
  • Vector type
    Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rac1
  • Alt name
    ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1990
  • Entrez Gene
    RAC1 (a.k.a. MIG5, MRD48, Rac-1, TC-25, p21-Rac1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • His (N terminal on backbone)
    • FRET Antenna (mCerulean-cpVenus) (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer aagtatcgggccctttgtgc
  • 3′ sequencing primer GGCAGCCTGCACCTGAGGTTAATCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTriEX-Antenna-GDI Rac1 was a gift from Klaus Hahn (Addgene plasmid # 83359 ; http://n2t.net/addgene:83359 ; RRID:Addgene_83359)
  • For your References section:

    FRET binding antenna reports spatiotemporal dynamics of GDI-Cdc42 GTPase interactions. Hodgson L, Spiering D, Sabouri-Ghomi M, Dagliyan O, DerMardirossian C, Danuser G, Hahn KM. Nat Chem Biol. 2016 Aug 8. doi: 10.1038/nchembio.2145. 10.1038/nchembio.2145 PubMed 27501396