Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

VanGlow-RR
(Plasmid #83343)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83343 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBPGw
  • Backbone manufacturer
    Rubin Lab
  • Backbone size (bp) 10726
  • Modifications to backbone
    The GAL4 sequence of pBPGw was replaced with a mCherry::Renilla(nls) reporter that is codon optimized for expression in Drosophila.
  • Vector type
    Insect Expression, Luciferase
  • Selectable markers
    miniwhite
  • Tag / Fusion Protein
    • mCherry::Renilla(nls) (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AAATAGGGGTTCCGCGCACAT
  • 3′ sequencing primer GCAGATTGTTTAGCTTGTTCAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

VanGlow-RR-promoter is a Gateway compatible vector enabling high throughput cloning of promoter elements upstream of a mCherry::Renilla(nls) reporter protein (codon optimized for expression in Drosophila) using Invitrogen LR clonase. This vector can be used for Renilla-luciferase assays in S2 cells and can be inserted into specific target sites in the Drosophila genome using PhiC31 integrase and used to assess reporter gene expression in vivo using Immunofluorescence, Live-Cell-Imaging, and Renilla-luciferase assays. In addition, this vector may be used in combination with other VanGlow transgenes to facilitate FACS purification of specific populations of cells.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VanGlow-RR was a gift from Cheng-Yu Lee (Addgene plasmid # 83343 ; http://n2t.net/addgene:83343 ; RRID:Addgene_83343)
  • For your References section:

    An Hdac1/Rpd3-Poised Circuit Balances Continual Self-Renewal and Rapid Restriction of Developmental Potential during Asymmetric Stem Cell Division. Janssens DH, Hamm DC, Anhezini L, Xiao Q, Siller KH, Siegrist SE, Harrison MM, Lee CY. Dev Cell. 2017 Feb 27;40(4):367-380.e7. doi: 10.1016/j.devcel.2017.01.014. 10.1016/j.devcel.2017.01.014 PubMed 28245922