VanGlow-RR-DSCP
(Plasmid #83339)

• Purpose: (Empty Backbone) for Gateway cloning of enhancer elements upstream of the DSCP and mCherry::Renilla(nls) reporter, facilitating qualitative and quantitative analysis of expression in transgenic fly lines and S2 cells.
• Depositing Lab: Cheng-Yu Lee
• Publication: Janssens et al Dev Cell. 2017 Feb 27;40(4):367-380.e7. doi: 10.1016/j.devcel.2017.01.014.

Backbone

• Vector backbone: pBPGUw
• Backbone manufacturer: Rubin Lab
• Backbone size (bp): 10876
• Modifications to backbone: The GAL4 sequence of pBPGUw was replaced with a mCherry::Renilla(nls) reporter that is codon optimized for expression in Drosophila.
• Vector type: Insect Expression, Luciferase
• Promoter: Drosophila Synthetic Core Promoter
• Selectable markers: miniwhite
• Tag / Fusion Protein:
  • mCherry::Renilla(nls) (C terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: AAATAGGGGTTCCGCGCACAT
• 3′ sequencing primer: GCAGATTGTTTAGCTTGTTCAGC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

VanGlow-RR-enhancer is a Gateway compatible vector enabling high throughput cloning of enhancer elements upstream of the Drosophila synthetic core promoter (DSCP) and a mCherry::Renilla(nls) reporter protein (codon optimized for expression in Drosophila) using Invitrogen LR clonase. This vector can be used for Renilla-luciferase assays in S2 cells and can be inserted into specific target sites in the Drosophila genome using PhiC31 integrase and used to assess reporter gene expression in vivo using Immunofluorescence, Live-Cell-Imaging, and Renilla-luciferase assays. In addition, this vector may be used in combination with other VanGlow transgenes to facilitate FACS purification of specific populations of cells.