pSELECT-HA-mFOXO1
(Plasmid #83308)

• Purpose: Expresses HA-tagged mouse FoxO1 in mammalian cells, PuroR selection marker
• Depositing Lab: Steven Abcouwer
• Publication: Kong et al Exp Eye Res. 2016 Aug 7;151:82-95. doi: 10.1016/j.exer.2016.08.002.

Backbone

• Vector backbone: pSELECT-puro
• Backbone manufacturer: Invivogen
• Backbone size w/o insert (bp): 3390
• Total vector size (bp): 5432
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): None
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Puromycin (100-150ug/mL) can be used for selection in E. coli
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FoxO1
• Species: M. musculus (mouse)
• Insert Size (bp): 1983
• GenBank ID: NM_ 019739.3
• Entrez Gene: Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
• Promoter: hEF1/HTLV prom
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GACCCTGCTTGCTCAACTCT
• 3′ sequencing primer: GTCTACGCTGCCCAGTCTGT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pCMV5-HA-FOXO1 containing mouse FOXO1 ORF fused to HA-tag was obtained from AddGene (plasmid 12142) originally constructed by Nakae and coworkers (JCI 108:1359, 2001
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • InvivoGen Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To construct pSELECT-HA-mFOXO1 the coding sequence of HA tag and FOXO1 were amplified from pCMV-HA-FOXO1 by PCR. The PCR product was digested with NheI and SalI restriction enzymes and inserted into the NheI and SalI sites of pSELECT-puro.
The insert was sequenced and compared to mouse FOXO1 (NM_019739.3). Sequence identity was confirmed except for a conservative A->G mutation at base 474, a non-conservative A->G mutation at base 1121 and a non-conservative mutation T->C mutation at base 2321 of NM_019739.3. These mutations were confirmed to exist in the original pCMV-HA-FOXO1 plasmid. The non-conservative mutations result in a K->R substitution at amino acid 219 and a L->P substitution at amino acid 619 of mFOXO1 (NP_062713.2).
Mutations at bases 1121 and 2321 were reversed to wild type by site-directed mutagenesis and the corrections were confirmed by sequencing