Skip to main content
Addgene

CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-Puro
(Plasmid #83306)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83306 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CSII
  • Backbone manufacturer
    RIKEN
  • Backbone size w/o insert (bp) 8009
  • Total vector size (bp) 14229
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA and dCas9 from pX330
  • Promoter U6 for sgRNA and CBh for dCas9
  • Tag / Fusion Protein
    • FLAG and PA tags (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGGCAGTATTCATCCACAATTT
  • 3′ sequencing primer CCACATAGCGTAAAAGGAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pX330 from Addgene. The CSII backbone is originally distributed from RIKEN, Japan. Registered trademark for PA tag: 5671624, permission from Dr. Yukinari Kato, Tohoku University, Japan
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-Puro was a gift from Tohru Kimura (Addgene plasmid # 83306 ; http://n2t.net/addgene:83306 ; RRID:Addgene_83306)
  • For your References section:

    A RUNX-CBFbeta-driven enhancer directs the Irf8 dose-dependent lineage choice between DCs and monocytes. Murakami K, Sasaki H, Nishiyama A, Kurotaki D, Kawase W, Ban T, Nakabayashi J, Kanzaki S, Sekita Y, Nakajima H, Ozato K, Kimura T, Tamura T. Nat Immunol. 2021 Mar;22(3):301-311. doi: 10.1038/s41590-021-00871-y. Epub 2021 Feb 18. 10.1038/s41590-021-00871-y PubMed 33603226