pTY07
(Plasmid
#83285)
-
Purposehuman CENP-A N-terminally labeled with LSSmOrange
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83285 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBABE-puro
- Backbone size w/o insert (bp) 5168
- Total vector size (bp) 6353
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecentromere protein A
-
Alt nameCENPA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1684
-
GenBank IDNC_000002.12
-
Entrez GeneCENPA (a.k.a. CENP-A, CenH3)
-
Tag
/ Fusion Protein
- LSSmOrange (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTTATCCAGCCCTCAC
- 3′ sequencing primer ACCCTAACTGACACACATTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTY07 was a gift from Daniel Needleman (Addgene plasmid # 83285 ; http://n2t.net/addgene:83285 ; RRID:Addgene_83285) -
For your References section:
Measuring NDC80 binding reveals the molecular basis of tension-dependent kinetochore-microtubule attachments. Yoo TY, Choi JM, Conway W, Yu CH, Pappu RV, Needleman DJ. Elife. 2018 Jul 25;7. pii: 36392. doi: 10.7554/eLife.36392. 36392 [pii] PubMed 30044223