-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 8328 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEX
-
Backbone manufactureramersham
- Backbone size w/o insert (bp) 4900
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecIAP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1700
-
Entrez GeneBIRC2 (a.k.a. API1, HIAP2, Hiap-2, MIHB, RNF48, c-IAP1, cIAP1)
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTGG
- 3′ sequencing primer TCCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pgex-cIAP1 was a gift from Jon Ashwell (Addgene plasmid # 8328 ; http://n2t.net/addgene:8328 ; RRID:Addgene_8328) -
For your References section:
TNF-RII and c-IAP1 mediate ubiquitination and degradation of TRAF2. Li X, Yang Y, Ashwell JD. Nature 2002 Mar 21;416(6878):345-7. 10.1038/416345a PubMed 11907583