Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TET-pLKO.1 PURO shID2 #2
(Plasmid #83087)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83087 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Tet-pLKO-puro
  • Backbone manufacturer
    Addgene #21915
  • Backbone size w/o insert (bp) 10633
  • Total vector size (bp) 8816
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    shID2
  • gRNA/shRNA sequence
    GACCACCCTCAACACGGATAT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_002166
  • Entrez Gene
    ID2 (a.k.a. GIG8, ID2A, ID2H, bHLHb26)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site E (not destroyed)
  • 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The targeting sequence was identified from the TRC (TRCN0000232079). Knockdown validated by Western blot of transient, ectopic expression of ID2 in 293T cells.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TET-pLKO.1 PURO shID2 #2 was a gift from Kevin Janes (Addgene plasmid # 83087 ; http://n2t.net/addgene:83087 ; RRID:Addgene_83087)
  • For your References section:

    Tumor-Suppressor Inactivation of GDF11 Occurs by Precursor Sequestration in Triple-Negative Breast Cancer. Bajikar SS, Wang CC, Borten MA, Pereira EJ, Atkins KA, Janes KA. Dev Cell. 2017 Nov 20;43(4):418-435.e13. doi: 10.1016/j.devcel.2017.10.027. 10.1016/j.devcel.2017.10.027 PubMed 29161592