pET_sfCherry(1-10)_32aalinker_sfCherry(11)
(Plasmid #83030)

• Purpose: Bacterial expression vector for split sfCherry screening
• Depositing Lab: Bo Huang
• Publication: Feng et al Nat Commun. 2017 Aug 29;8(1):370. doi: 10.1038/s41467-017-00494-8.

Backbone

• Vector backbone: pET28a
• Backbone size w/o insert (bp): 5296
• Total vector size (bp): 6067
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Transform plasmid into BL21 for protein expression. Induce protein expression by IPTG.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: sfCherry(1-10)_32aalinker_sfCherry(11)
• Alt name: split sfCherry flanked by 32-residue linker
• Species: Synthetic
• Insert Size (bp): 771
• Promoter: T7 promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry