Skip to main content
Addgene

Fv-hCaspase 8 (C/A)-2A-GFP
(Plasmid #82713)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82713 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBabe
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 7116
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Fv-Caspase 8 (C/A)-2A-GFP
  • Alt name
    dimerizale caspase 8
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2016
  • Mutation
    deleted amino acids 1-215 of caspase 8
  • GenBank ID
    NM_001080125.1
  • Entrez Gene
    CASP8 (a.k.a. ALPS2B, CAP4, Casp-8, FLICE, MACH, MCH5)
  • Tag / Fusion Protein
    • FKBP dimerization domain (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer ctttatccagccctcac
  • 3′ sequencing primer accctaactgacacacattcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Fv-hCaspase 8 (C/A)-2A-GFP was a gift from Douglas Green (Addgene plasmid # 82713)
  • For your References section:

    Inducible dimerization and inducible cleavage reveal a requirement for both processes in caspase-8 activation. Oberst A, Pop C, Tremblay AG, Blais V, Denault JB, Salvesen GS, Green DR. J Biol Chem. 2010 May 28;285(22):16632-42. doi: 10.1074/jbc.M109.095083. Epub 2010 Mar 22. 10.1074/jbc.M109.095083 PubMed 20308068