Fv-hCaspase 8-2A-GFP
(Plasmid #82712)

• Purpose: express human caspase 8 in mammalian cells
• Depositing Lab: Douglas Green
• Publication: Oberst et al J Biol Chem. 2010 May 28;285(22):16632-42. doi: 10.1074/jbc.M109.095083. Epub 2010 Mar 22.

Backbone

• Vector backbone: pBabe
• Backbone size w/o insert (bp): 5100
• Total vector size (bp): 7116
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Fv-Caspase 8-2A-GFP
• Alt name: dimerizale caspase 8
• Species: H. sapiens (human)
• Insert Size (bp): 2016
• Mutation: deleted amino acids 1-215 of caspase 8
• GenBank ID: NM_001080125.1
• Entrez Gene: CASP8 (a.k.a. ALPS2B, CAP4, Casp-8, FLICE, MACH, MCH5)
• Promoter: LTR
• Tag / Fusion Protein:
  • FKBP dimerization domain (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: ctttatccagccctcac
• 3′ sequencing primer: accctaactgacacacattcc

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry