-
PurposeBacterial expression vector for split mNeonGreen2 screening
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82611 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5296
- Total vector size (bp) 6082
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsuse BL21 or similar for protein expression. induce protein expression by IPTG
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemNeonGreen2(1-10)_32aalinker_mNeonGreen2(11)
-
SpeciesSynthetic
-
Insert Size (bp)786
-
Mutationsplit before mutations
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CTCAAGACCCGTTTAGAGGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
In the mNG2(1-10) fragment, mutations are K128M, S142T, R150M, G172V and K213M; in the mNG2(11) fragment, mutation is V15M.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET_mNG2(1-10)_32aalinker_mNG2(11) was a gift from Bo Huang (Addgene plasmid # 82611 ; http://n2t.net/addgene:82611 ; RRID:Addgene_82611) -
For your References section:
Improved split fluorescent proteins for endogenous protein labeling. Feng S, Sekine S, Pessino V, Li H, Leonetti MD, Huang B. Nat Commun. 2017 Aug 29;8(1):370. doi: 10.1038/s41467-017-00494-8. 10.1038/s41467-017-00494-8 PubMed 28851864