Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP_sfCherry2(11)_HP1
(Plasmid #82607)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82607 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-mEmerald-HP1b
  • Backbone manufacturer
    Michael Davidson Fluorescent Protein Collection at the UCSF Nikon Imaging center
  • Backbone size w/o insert (bp) 6500
  • Total vector size (bp) 6500
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sfCherry2(11)_HP1b
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1518
  • Mutation
    changed Gly12 to Ala in sfCherry11+

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BmtI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ATCCGCTAGCGCTACCGGTC
  • 3′ sequencing primer GTGGTATGGCTGATTATGATC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP_sfCherry2(11)_HP1 was a gift from Bo Huang (Addgene plasmid # 82607 ; http://n2t.net/addgene:82607 ; RRID:Addgene_82607)
  • For your References section:

    Improved split fluorescent proteins for endogenous protein labeling. Feng S, Sekine S, Pessino V, Li H, Leonetti MD, Huang B. Nat Commun. 2017 Aug 29;8(1):370. doi: 10.1038/s41467-017-00494-8. 10.1038/s41467-017-00494-8 PubMed 28851864