bbCas9pluspAAA
(Plasmid #82581)

• Purpose: The plasmid encodes the T7 promoter, Cas9 (from pX330 #42230) and a stretch of poly-A. After linearization with restriction enzyme SapI It is used to produce in vitro transcribed mRNA
• Depositing Lab: Ivo Huijbers
• Publication: Pritchard et al Methods Mol Biol. 2017;1642:21-35. doi: 10.1007/978-1-4939-7169-5_2.

Backbone

• Vector backbone: pUC
• Backbone size w/o insert (bp): 1932
• Total vector size (bp): 6397
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9
• Alt name: humanized Cas9
• Species: S. pyogenes
• Promoter: T7

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CTGCGTTATCCCCTGATTCTGTGG
• 3′ sequencing primer: GGGCGACACGGAAATGTTGAATAC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cas9 insert is cloned from pX330 Addgene #42230