Skip to main content
Addgene

pX330-Puro-ccdB
(Plasmid #82580)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82580 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC
  • Backbone size (bp) 3500
  • Vector type
    Mammalian Expression
  • Promoter CBh
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene #42230
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid is a modification of Addgene:
42230 - pX330-U6-Chimeric_BB-CBh-hSpCas9

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-Puro-ccdB was a gift from Ivo Huijbers (Addgene plasmid # 82580 ; http://n2t.net/addgene:82580 ; RRID:Addgene_82580)

  • For your References section:

    Direct Generation of Conditional Alleles Using CRISPR/Cas9 in Mouse Zygotes. Pritchard CEJ, Kroese LJ, Huijbers IJ. Methods Mol Biol. 2017;1642:21-35. doi: 10.1007/978-1-4939-7169-5_2. 10.1007/978-1-4939-7169-5_2 PubMed 28815491
Related items:
Commonly requested with: