FSW-HRP-V5-LRRTM2
(Plasmid #82537)

• Purpose: Lentiviral vector for expressing HRP-LRRTM2 in neurons
• Depositing Lab: Alice Ting
• Publication: Loh et al Cell. 2016 Aug 25;166(5):1295-1307.e21. doi: 10.1016/j.cell.2016.07.041.

Backbone

• Vector backbone: FSW
• Backbone size w/o insert (bp): 9543
• Total vector size (bp): 10995
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LRRTM2
• Species: H. sapiens (human)
• Insert Size (bp): 1452
• Entrez Gene: LRRTM2
• Promoter: Human Synapsin
• Tags / Fusion Proteins:
  • HRP (N terminal on insert)
  • V5 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: GCGCTGCGGCGCCGGCGACTCAGC
• 3′ sequencing primer: gcgtaaaaggagcaacatagttaagaataccagtcaatc

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry