Skip to main content
Addgene

pTRIPZ (M)-YFP-Ezh2
(Plasmid #82511)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82511 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTRIPZ (M)
  • Backbone size w/o insert (bp) 12960
  • Total vector size (bp) 15960
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Enhancer Of Zeste 2 Polycomb Repressive Complex 2
  • Alt name
    Ezh2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2241
  • GenBank ID
    XM_005249962
  • Entrez Gene
    EZH2 (a.k.a. ENX-1, ENX1, EZH2b, KMT6, KMT6A, WVS, WVS2)
  • Promoter cmv
  • Tag / Fusion Protein
    • YFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (unknown if destroyed)
  • 3′ cloning site Mlu1 (unknown if destroyed)
  • 5′ sequencing primer cgtgaccgccgccgggatcactctc
  • 3′ sequencing primer cctcacggcgagcgctgccacgtca
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIPZ (M)-YFP-Ezh2 was a gift from Xiaojun Ren (Addgene plasmid # 82511)
Related items: