pGLO-GFP-3UAG
(Plasmid #82501)

• Purpose: Expresses GFP with 3 UAG codons at the amino acid position 3, 151, and 153
• Depositing Lab: Chang Liu
• Publication: Schwessinger et al Integr Biol (Camb). 2016 Apr 18;8(4):542-5. doi: 10.1039/c5ib00232j. Epub 2015 Nov 27.

Backbone

• Vector backbone: pGLO
• Backbone manufacturer: Bio-Rad
• Backbone size w/o insert (bp): 4651
• Total vector size (bp): 5374
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Growth instructions: The SS320 strain was used in the associated publication.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Green Fluorescence Protein with 3 UAG codons
• Alt name: GFP-3UAG
• Species: Aequorea victoria
• Insert Size (bp): 723
• Mutation: Added an UAG codon at the amino acid position 3, changed asparagine at position 151 and tyrosine at position 153 to an UAG codon
• Promoter: AraBAD

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCATTCTGTAACAAAGCGGG
• 3′ sequencing primer: CTGATTTAATCTGTATCAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry