Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMCh-1480
(Plasmid #82426)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82426 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEBG
  • Backbone manufacturer
    Addgene 22227
  • Backbone size w/o insert (bp) 5967
  • Total vector size (bp) 7603
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nvGW182 CED
  • Species
    Nematostella vectensis
  • Insert Size (bp)
    1636
  • Mutation
    amino acids 1-1158 of nvGW182 were deleted
  • Promoter EF1A
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SbfI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer atagcatggcctttgcaggg
  • 3′ sequencing primer ACAGGGATTTCTTGTCTCCCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMCh-1480 was a gift from Marina Chekulaeva (Addgene plasmid # 82426 ; http://n2t.net/addgene:82426 ; RRID:Addgene_82426)
  • For your References section:

    Conservation of miRNA-mediated silencing mechanisms across 600 million years of animal evolution. Mauri M, Kirchner M, Aharoni R, Ciolli Mattioli C, van den Bruck D, Gutkovitch N, Modepalli V, Selbach M, Moran Y, Chekulaeva M. Nucleic Acids Res. 2016 Sep 6. pii: gkw792. 10.1093/nar/gkw792 PubMed 27604873