pMCh-1478
(Plasmid
#82424)
-
PurposePlasmid for expression of GST-tagged Nematostella vectensis GW182 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82424 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEBG
-
Backbone manufacturerAddgene 22227
- Backbone size w/o insert (bp) 5967
- Total vector size (bp) 11074
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenvGW182
-
SpeciesNematostella vectensis
-
Insert Size (bp)5107
- Promoter EF1A
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer atagcatggcctttgcaggg
- 3′ sequencing primer ACAGGGATTTCTTGTCTCCCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMCh-1478 was a gift from Marina Chekulaeva (Addgene plasmid # 82424 ; http://n2t.net/addgene:82424 ; RRID:Addgene_82424) -
For your References section:
Conservation of miRNA-mediated silencing mechanisms across 600 million years of animal evolution. Mauri M, Kirchner M, Aharoni R, Ciolli Mattioli C, van den Bruck D, Gutkovitch N, Modepalli V, Selbach M, Moran Y, Chekulaeva M. Nucleic Acids Res. 2016 Sep 6. pii: gkw792. 10.1093/nar/gkw792 PubMed 27604873