-
PurposeLentiviral vector expressing Cre recombinase alongside Cas9 and an sgRNA cloning site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiCRISPR v2 (Addgene #52961)
-
Backbone manufacturerFeng Zhang
- Total vector size (bp) 13459
-
Modifications to backboneCloned in Cre to replace Puro resistance
-
Vector typeLentiviral, Cre/Lox, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCre Recombinase
-
Alt nameCre
-
SpeciesP1 Phage
-
Insert Size (bp)1050
-
MutationMutated BsmBI cut site
- Promoter EFS (P2A)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCGAGAAGAATCCCATCGACTTTCTGGAAGCCAAGGGCTA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sgRNA of choice is cloned into vector using Golden Gate assembly, with BsmBI restriction enzyme (as per resource information on Addgene plasmid #52961 by Feng Zhang).
sgRNA sequencing primer is as follows: 5'-TACGTGACGTAGAAAGTA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPRv2Cre was a gift from David Feldser (Addgene plasmid # 82415 ; http://n2t.net/addgene:82415 ; RRID:Addgene_82415) -
For your References section:
Systematic in vivo inactivation of chromatin regulating enzymes identifies Setd2 as a potent tumor suppressor in lung adenocarcinoma. Walter DM, Venancio OS, Buza EL, Tobias JW, Deshpande C, Gudiel AA, Kim-Kiselak C, Cicchini M, Yates TJ, Feldser DM. Cancer Res. 2017 Feb 15. pii: canres.2159.2016. doi: 10.1158/0008-5472.CAN-16-2159. 10.1158/0008-5472.CAN-16-2159 PubMed 28202515