Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCas45
(Plasmid #82390)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82390 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 5545

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA
  • gRNA/shRNA sequence
    YFP
  • Promoter PJ23119

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTGGGTAACGCCAGGGT
  • 3′ sequencing primer GCTTCCGGCTCGTATGTTGTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCas45 was a gift from Brian Pfleger (Addgene plasmid # 82390 ; http://n2t.net/addgene:82390 ; RRID:Addgene_82390)
  • For your References section:

    CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Gordon GC, Korosh TC, Cameron JC, Markley AL, Begemann MB, Pfleger BF. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. 10.1016/j.ymben.2016.07.007 PubMed 27481676