Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFUSE2ss-CLIg-mK_M18
(Plasmid #82358)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 82358 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFUSE2ss-CLIg-mK
  • Backbone manufacturer
    Invivogen
  • Backbone size w/o insert (bp) 3862
  • Total vector size (bp) 4177
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Blasticidin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Top10 or DH5alpha could be selected on LB LOW SALT with 100 micrograms/ml Blasticidin.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse immunoglobulin kappa light chain, variable fragment derived from clone M18
  • Alt name
    Igk
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    339
  • GenBank ID
    NC_000072.6
  • Entrez Gene
    Igk (a.k.a. kappa)
  • Entrez Gene
    Igkc (a.k.a. Igk-C)
  • Entrez Gene
    Igk-V
  • Promoter hEF1-HTLV prom
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BstAPI (not destroyed)
  • 5′ sequencing primer AGATGTTGTTCTGACCCAAACTC
  • 3′ sequencing primer ACACTCATTCCTGTTGAAGCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUSE2ss-CLIg-mK_M18 was a gift from Joanna Bereta (Addgene plasmid # 82358 ; http://n2t.net/addgene:82358 ; RRID:Addgene_82358)
  • For your References section:

    Agglutinating mouse IgG3 compares favourably with IgMs in typing of the blood group B antigen: Functionality and stability studies. Klaus T, Bzowska M, Kulesza M, Kabat AM, Jemiola-Rzeminska M, Czaplicki D, Makuch K, Jucha J, Karabasz A, Bereta J. Sci Rep. 2016 Aug 3;6:30938. doi: 10.1038/srep30938. 10.1038/srep30938 PubMed 27484487